Several methods for the diagnosis and identification of species and subspecies of Leishmania have been developed and used, such as analysis of isoenzymes by electrophoresis, immunological methods and PCR derived techniques, such as RAPD (random amplified polymorphic DNA), and SSR-PCR (simple sequence repeat anchored-PCR). However, such techniques depend on the previous isolation of the parasites, requiring leishmanias to be initially cultivated from biological  samples, and later multiplied in cultures. Not unfrequently, culture is unsuccessful, and it is possible that some intra-specific variants can be selected during the culture, resulting in misrepresentation of the heterogeneity of the original population. Thus, more reliable and precise identification of populations of  Leishmania is important for a better clinical and epidemiological understanding of the disease. In the present communication, we show that kDNA signatures produced by LSSP-PCR is able to identify inter- and intra-specific genetic variants of Leishmania. DNA was purified from isolates corresponding to different species (L. chagasi, L. guyanensis, , L. panamensis, L. mexicana, L. major, L. tropica, L. donovani, and L. amazonensi). Their minicircles were amplified with the pair of primers LSUC (caaactgggggttggtgtaa) and LSUL (ttttgaacggggtttctg), that are specific for parasites of the genus Leshmania. Then, LSSP-PCR was peformed. LSSP-PCR produced complex and distinct kDNA signatures for the nine isolates representing different species. In addition, analyzing different isolates of L. braziliensis, the approach had the potential for discriminating intra-specific variants. In conclusion, LSSP-PCR targeting kDNA mincircles produces profiles that reflect polymorphisms of the predominant class of minicircle in each Leishmania population, allowing for the identification of different populations of the parasite.