Rhizobia are nitrogen-fixing bacteria that form symbiotic associations with legumes through special structures known as nodules. Recently, there were descriptions of bacterial species beyond Rhizobia, able to nodulate and fix nitrogen symbiotically with legumes. These include many representatives of b-proteobacteria, such as Ralstonia and Burkholderia. Forty eight strains of bacteria isolated from surface sterilized nodules of common bean, cultivated in soils from Campo Belo do Sul – SC, were analyzed by 16S rDNA gene sequencing. The soils were under tree management systems: no tillage (NT), conventional tillage (CT) and native field (NF). A 5´ end fragment of the 16SrDNA gene of approximately 300 bp was amplified by PCR with the primers Y1 (TGGCTCAGAACGAACGCTGGCGGC) and Y2 (CCCACTGCTGCCTCCCGTAGGAGT). Primers 16S362f (CTCCTACGGGAGGCAGCAGTGGGG) and Y3 (TACCTTGTTACGACTTCACCCCAGTC) were used to amplify a fragment of approximately 1000 bp of the 16SrDNA gene of four strains that failed to amplify with Y1/Y2. The assembling of the consensus sequence was performed used a PHRED/PHRAP/CONSED package. The sequences of thirty-three strains under no tillage management, fifteen strains under conventional tillage and one strain from native field were obtained. A similarity search against Genbank and RDP II databases and phylogenetic analysis revealed close similarities with the genera: Rhizobium (21 strains from NT soil, 7 strains from CT and 1 strain from NF), Agrobacterium (2 strains from NT soil, 1 strain from CT soil), Sphingomonas (1 strain from CT soil) and Caulobacter (1 from NT soil) belonging to the a-proteobacteria; Burkholderia (1 from NT soil and 2 from CT), Ralstonia (6 from NT soil and 3 from CT soil) (b-proteobacteria), Microbacterium (Actinobacteria)(1 from NT soil) and Pseudomonas (g-proteobacteria)(1 strain from CT soil). These results indicate that a large and variable community of bacteria can nodulate or participate  in the nodule bacterial populations of common bean.